What Primer Sequences offered at CUGI ?

CUGI offers the following primers for reaction with your samples.
Primer Name Sequence Direction Abbreviation appended to sequence name
T3 AATTAACCCTCACTAAAGGG 5' -> 3' (forward) T3
T7 TAATACGACTCACTATAGGG 5' -> 3' (forward) T7
Sp6 GCTATTTAGGTGACACTATAG 5' -> 3' (forward) Sp6
M13R GGAAACAGCTATGACCATG 3' -> 5' (reverse) M13R
M13F GTAAAACGACGGCCAG 5' -> 3' (forward) M13F
pIndigoBACF GGATGTGCTGCAAGGCGATTAAGTTGG 5' -> 3' (forward) pIBF
pIndigoBACR CTCGTATGTTGTGTGGAATTGTGAGC 3' -> 5' (reverse) pIBR
T7terminator GCTAGTTATTGCTCAGCGG 5' -> 3' (forward) T7t