Frequently Asked Questions
- What Primer Sequences offered at CUGI ?
- How do I prepare my template plus primer for sequencing
- What sample names can I use for sequencing?
- What is meant by dried down or suspended samples?
- Should I send plates or tubes for sequencing?
- How to prepare samples for sequencing?
- What is High Copy and Low Copy Sequencing
- Where do I send my samples for sequencing?
- How do I download and extract my DNA Sequences?
| Primer Name | Sequence | Direction | Abbreviation appended to sequence name |
|---|---|---|---|
| T3 | AATTAACCCTCACTAAAGGG | 5' -> 3' (forward) | T3 |
| T7 | TAATACGACTCACTATAGGG | 5' -> 3' (forward) | T7 |
| Sp6 | GCTATTTAGGTGACACTATAG | 5' -> 3' (forward) | Sp6 |
| M13R | GGAAACAGCTATGACCATG | 3' -> 5' (reverse) | M13R |
| M13F | GTAAAACGACGGCCAG | 5' -> 3' (forward) | M13F |
| pIndigoBACF | GGATGTGCTGCAAGGCGATTAAGTTGG | 5' -> 3' (forward) | pIBF |
| pIndigoBACR | CTCGTATGTTGTGTGGAATTGTGAGC | 3' -> 5' (reverse) | pIBR |
| T7terminator | GCTAGTTATTGCTCAGCGG | 5' -> 3' (forward) | T7t |
Our online sequencing worksheet will allow you to specify your own primers. You must provide your primer name, the primer concentration and the melting temperature for your primer. Be sure to send your custom primer with your samples.
- For High copy sequencing, CUGI uses 1pmol of primer per reaction. If you add primer yourself, add .5µl of 2pmol stock to resuspended template or 1pmols and dry down. If you send an aliquot for CUGI to add send 10µM stock.
- For Low copy sequencing, CUGI uses 50pmol per reaction. If you add primer yourself, add 1ul of 50pmol stock to resuspended template or 50pmols and dry down. If you send an aliquot for CUGI to add send 50µM stock.
The online sequencing worksheet will allow that you provide your own sample and plate names for the samples you send. Be sure to clearly label plates as well as any samples sent in tubes. Our instrumentation requires that sample and plate names be kept simple. Names can contain the following characters: alphanumeric, dashes, underscores and periods. Names must be 15 characters or less.
Dried down samples are completely dried or lypholized. Resuspended samples should be in no more than 3µl.
CUGI operates in 96-well format. It is optimal to send 96-well plates, but tubes are accepted in no more than 48 per order. Please ship samples to arrive on Tuesday through Friday. No weekend deliveries
Instructions for preparing samples for sequencing can be found on the sample prep protocol page.
CUGI uses copy number information to determine the quantity of sequencing reagents and template concentration needed for a sequencing reaction.
High copy refers to a high copy number of plasmids per cell (>300) and PCR amplicons. Typically, high copy plasmids contain inserts 10kb in size or less. Examples of high copy plasmids are pGEM, TOPO, pBlueskript, etc. Low copy refers to a low copy number of plasmids per cell (1-20). Typically, these are BACs, fosmids, and some expression vectors.
Delivery instructions for sending samples for DNA sequencing can be found on the sample preparation protocol page.
For Windows Users:
The easiest way for you to access your FTP account is to use your "My Computer" window ( not a web browser).
Click on the 'My Computer' icon. In the address bar type the link provided in results e-mail ftp://username:password@ftp.genome.clemson.edu .
Internet Explorer version 7 will not work for using password protected FTP accounts. Version 6 will work fine.
Mozilla Firefox requires you to simply cut and paste your FTP link into the address bar.
http://www.7-zip.org/ is a free utility that you can use to open your files.